ptf1a

Ensembl ID:
ENSDARG00000014479
ZFIN ID:
ZDB-GENE-030616-579
Description:
Pancreas transcription factor 1 subunit alpha [Source:UniProtKB/Swiss-Prot;Acc:Q7ZSX3]
Human Orthologue:
PTF1A
Human Description:
pancreas specific transcription factor, 1a [Source:HGNC Symbol;Acc:23734]
Mouse Orthologue:
Ptf1a
Mouse Description:
pancreas specific transcription factor, 1a Gene [Source:MGI Symbol;Acc:MGI:1328312]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa126 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021987 Nonsense 150 265 1 2
Genomic Location:
Chromosome 2 (position 29426136)
KASP Assay ID:
554-0206.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTTTCGAGGGACTGCGATCTCACATCCCAACACTGCCATACGAGAAG[A/T]GACTTTCAAAAGTTGACACTTTACGCCTAGCAATTGGCTACATAAACTTT
Associated Phenotype:
Data not yet available
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
2:15447301-15447550 15447550 1 < 1 × 10-16 -8.0 -5 amy2a ENSDARG00000013856
25:18947217-18947900 18947217 -1 < 1 × 10-16 -8.6 -3 cpa5 ENSDARG00000021339
8:21907052-21907500 21907052 -1 5.77 × 10-234 -10.3 -3 ela2l ENSDARG00000056765
7:36516813-36517300 36516813 -1 1.12 × 10-207 -10.4 -4 zgc:112160 ENSDARG00000039730
24:4835111-4836200 4835111 -1 4.19 × 10-159 -8.1 0 cpb1 ENSDARG00000045442

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u4n6panp