eif4a3

Ensembl ID:
ENSDARG00000014472
ZFIN ID:
ZDB-GENE-040426-915
Description:
Eukaryotic initiation factor 4A-III [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVA6]
Human Orthologue:
EIF4A3
Human Description:
eukaryotic translation initiation factor 4A3 [Source:HGNC Symbol;Acc:18683]
Mouse Orthologues:
Eif4a3, Gm5576, Gm8994
Mouse Descriptions:
eukaryotic translation initiation factor 4A3 Gene [Source:MGI Symbol;Acc:MGI:1923731]
predicted gene 8994 Gene [Source:MGI Symbol;Acc:MGI:3644226]
predicted pseudogene 5576 Pseudogene [Source:MGI Symbol;Acc:MGI:3644832]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35168 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014887 Nonsense 131 406 5 12
Genomic Location (Zv9):
Chromosome 11 (position 45996794)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44854587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGTGGTTCTCCAGGTTTTACTGGCTCTGGGCGACTACATGAACGTT[C/T]AGTGTCACGCGTGTATCGGCGGCACAAATGTCGGTGAAGACATCCGGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link