usf1l

Ensembl ID:
ENSDARG00000014463
ZFIN ID:
ZDB-GENE-040426-2269
Description:
upstream transcription factor 1 like [Source:RefSeq peptide;Acc:NP_998359]
Human Orthologue:
USF1
Human Description:
upstream transcription factor 1 [Source:HGNC Symbol;Acc:12593]
Mouse Orthologue:
Usf1
Mouse Description:
upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18350 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005263 Nonsense 42 283 4 11
ENSDART00000137558 Nonsense 42 218 4 10
ENSDART00000146963 Nonsense 42 212 4 9
ENSDART00000147569 Nonsense 42 212 3 8

The following transcripts of ENSDARG00000014463 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 31445399)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCACTTGCRGTCACAGCCATCCAAWCAGCTGCTGCATTTTCAACWGAC[C/T]AGCAAATTAAGTATCATTTTCTAAAAGCGGAAGCAACAGGGGGACAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s9k30epy