A3KP27_DANRE

Ensembl ID:
ENSDARG00000014439
Description:
DGKI protein [Source:UniProtKB/TrEMBL;Acc:A3KP27]
Human Orthologue:
DGKZ
Human Description:
diacylglycerol kinase, zeta 104kDa [Source:HGNC Symbol;Acc:2857]
Mouse Orthologue:
Dgkz
Mouse Description:
diacylglycerol kinase zeta Gene [Source:MGI Symbol;Acc:MGI:1278339]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21025 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40964 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1893 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa21025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024170 Essential Splice Site 133 296 2 8
ENSDART00000092187 Essential Splice Site 98 272 2 9
ENSDART00000093009 Essential Splice Site 281 1122 3 35
Genomic Location (Zv9):
Chromosome 7 (position 40473797)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38810437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCCAAAGGGGAAACGGACAGAGAAATACGCAACACAGTAGACTGGAGT[G/A]TGAGTTACAAGAGTCATCAAGACTTCTGATCTCCATTCACTGTATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024170   None 296 None 8
ENSDART00000092187   None 272 None 9
ENSDART00000093009 Essential Splice Site 699 1122 18 35
Genomic Location (Zv9):
Chromosome 7 (position 40487021)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38823661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTGATGGGCAGCTCCAAAGACCTGGCTAAGCACATCAAAGTAGTCG[T/C]ATGTACAGTATTAAACTAAACAAATATATTTTTCTGGAGACAATAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1893
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024170   None 296 None 8
ENSDART00000092187   None 272 None 9
ENSDART00000093009 Essential Splice Site 925 1122 25 35
Genomic Location (Zv9):
Chromosome 7 (position 40508303)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38844943
KASP Assay ID:
554-1883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACAGCTACAACTGCTGATCGATTCTACAGGATTGATCGAGCTCAAG[T/C]GAGTTGTACATACAATACCTCTTAGAGTAATTCATGCTACAATTGAGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link