A3KP27_DANRE

Ensembl ID:
ENSDARG00000014439
Description:
DGKI protein [Source:UniProtKB/TrEMBL;Acc:A3KP27]
Human Orthologue:
DGKZ
Human Description:
diacylglycerol kinase, zeta 104kDa [Source:HGNC Symbol;Acc:2857]
Mouse Orthologue:
Dgkz
Mouse Description:
diacylglycerol kinase zeta Gene [Source:MGI Symbol;Acc:MGI:1278339]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21025 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1893 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa21025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024170 Essential Splice Site 133 296 2 8
ENSDART00000092187 Essential Splice Site 98 272 2 9
ENSDART00000093009 Essential Splice Site 281 1122 3 35
Genomic Location:
Chromosome 7 (position 40473797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCCAAAGGGGAAACGGACAGAGAAATACGCAACACAGTAGACTGGAGT[G/A]TGAGTTACAAGAGTCATCAAGACTTCTGATCTCCATTCACTGTATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1893
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024170 None None 296 None 8
ENSDART00000092187 None None 272 None 9
ENSDART00000093009 Essential Splice Site 925 1122 25 35
Genomic Location:
Chromosome 7 (position 40508303)
KASP Assay ID:
554-1883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACAGCTACAACTGCTGATCGATTCTACAGGATTGATCGAGCTCAAG[T/C]GAGTTGTACATACAATACCTCTTAGAGTAATTCATGCTACAATTGAGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4yfc2ftq