rabgef1

Ensembl ID:
ENSDARG00000014430
ZFIN ID:
ZDB-GENE-040426-1486
Description:
rab5 GDP/GTP exchange factor [Source:RefSeq peptide;Acc:NP_957137]
Human Orthologues:
KCTD7, RABGEF1
Human Descriptions:
potassium channel tetramerisation domain containing 7 [Source:HGNC Symbol;Acc:21957]
RAB guanine nucleotide exchange factor (GEF) 1 [Source:HGNC Symbol;Acc:17676]
Mouse Orthologue:
Rabgef1
Mouse Description:
RAB guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI Symbol;Acc:MGI:1929459]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21763 Nonsense Mutation detected in F1 DNA During 2014
sa10271 Nonsense Available for shipment Available now
sa9546 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018977 Nonsense 43 502 1 8
ENSDART00000099827 Nonsense 43 218 2 4
ENSDART00000133421 Nonsense 49 212 1 4
ENSDART00000138243 Nonsense 43 502 2 9
Genomic Location:
Chromosome 10 (position 33831997)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAATGCTGCCTGGCAGGGCCTGTGCTCCAAGTGCTGGAGGGACGAATA[T/A]CAGAAAGCTCGGCAGAGGCAGATCCAGGATGACTGGGCTCTGGCAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018977 Nonsense 484 502 8 8
ENSDART00000099827 Nonsense 200 218 4 4
ENSDART00000133421 None None 212 None 4
ENSDART00000138243 Nonsense 484 502 9 9
ENSDART00000018977 Nonsense 484 502 8 8
ENSDART00000099827 Nonsense 200 218 4 4
ENSDART00000133421 None None 212 None 4
ENSDART00000138243 Nonsense 484 502 9 9
Genomic Location:
Chromosome 10 (position 33813480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCGATACCCGCTGGACATCAAACCAYGCGCATCAGCGATCGATGCC[G/T]AAAACGTGGAGAACGACAGGCTGCCACCTCCACTTCAGCCACAAGTSTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018977 Nonsense 484 502 8 8
ENSDART00000099827 Nonsense 200 218 4 4
ENSDART00000133421 None None 212 None 4
ENSDART00000138243 Nonsense 484 502 9 9
ENSDART00000018977 Nonsense 484 502 8 8
ENSDART00000099827 Nonsense 200 218 4 4
ENSDART00000133421 None None 212 None 4
ENSDART00000138243 Nonsense 484 502 9 9
Genomic Location:
Chromosome 10 (position 33813480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCGATACCCGCTGGACATCAAACCAYGCGCATCAGCGATCGATGCC[G/T]AAAACGTGGAGAACGACAGGCTGCCACCTCCACTTCAGCCACAAGTSTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aortic root size: Genome-wide joint SNP and CNV analysis of aortic root diameter in African Americans: the HyperGEN study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vfs8k9mf