LOC797354

Ensembl ID:
ENSDARG00000014402
Human Orthologue:
SMC1B
Human Description:
structural maintenance of chromosomes 1B [Source:HGNC Symbol;Acc:11112]
Mouse Orthologue:
Smc1b
Mouse Description:
structural maintenance of chromosomes 1B Gene [Source:MGI Symbol;Acc:MGI:2154049]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24632 Nonsense Mutation detected in F1 DNA During 2014
sa24631 Nonsense Mutation detected in F1 DNA During 2014
sa16356 Nonsense Available for shipment Available now
sa5099 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 201 1225 4 28
ENSDART00000125164 Nonsense 198 1236 4 29
Genomic Location:
Chromosome 25 (position 16935438)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCCAGTTCCACTTTAACAGGAAGAAAGCGGCTACAGCTGAGAAGAAA[C/T]AAGTCTTTAAAGATAAGACAGAGGTATTACACTGAAACCTGTAACAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 264 1225 5 28
ENSDART00000125164 Nonsense 261 1236 5 29
Genomic Location:
Chromosome 25 (position 16935161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGCAGGCAGCCGCAGCGCAGCAGAAGATCAGCCTGGACGCCTGGGAA[C/T]AAACTGTAAAGACCCAGAAGAAAGAACATGGGCGTCTGAACAGAGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 371 1225 8 28
ENSDART00000125164 Nonsense 368 1236 8 29
Genomic Location:
Chromosome 25 (position 16933371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAATAAWAGGGCAATGTTAAGCTGATGTTATATTATGTTTGTCTGTG[C/T]AGTTGGAGCGTTATAAGGAACTCAAAGAGTTAGCTAGAAGGAACGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Essential Splice Site 992 1225 22 28
ENSDART00000125164 Essential Splice Site 999 1236 23 29
Genomic Location:
Chromosome 25 (position 16919544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCGCAGATGGTGTTTGATTTTTCTGCATTGGACAACAGCCTTAAGG[T/C]AGAATTTGAGGTCTMTCTCAGATTCATTCTTATGTTGTTGAAGTGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/inmvkewr