LOC797354

Ensembl ID:
ENSDARG00000014402
Human Orthologue:
SMC1B
Human Description:
structural maintenance of chromosomes 1B [Source:HGNC Symbol;Acc:11112]
Mouse Orthologue:
Smc1b
Mouse Description:
structural maintenance of chromosomes 1B Gene [Source:MGI Symbol;Acc:MGI:2154049]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44260 Nonsense Mutation detected in F1 DNA During 2016
sa24632 Nonsense Mutation detected in F1 DNA During 2016
sa24631 Nonsense Mutation detected in F1 DNA During 2016
sa16356 Nonsense Available for shipment Available now
sa38036 Nonsense Mutation detected in F1 DNA During 2016
sa38035 Nonsense Mutation detected in F1 DNA During 2016
sa44259 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5099 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 125 1225 3 28
ENSDART00000125164 Nonsense 122 1236 3 29
Genomic Location:
Chromosome 25 (position 16935765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGTGAATGGTAAACATGTCACTTTGGCGAAGTACACTGGAGAGCTG[C/T]AGAAGATCGGCATCGTGGTGAAAGCCAAGAATTGTCTTGTGTATCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 201 1225 4 28
ENSDART00000125164 Nonsense 198 1236 4 29
Genomic Location:
Chromosome 25 (position 16935438)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCCAGTTCCACTTTAACAGGAAGAAAGCGGCTACAGCTGAGAAGAAA[C/T]AAGTCTTTAAAGATAAGACAGAGGTATTACACTGAAACCTGTAACAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 264 1225 5 28
ENSDART00000125164 Nonsense 261 1236 5 29
Genomic Location:
Chromosome 25 (position 16935161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGCAGGCAGCCGCAGCGCAGCAGAAGATCAGCCTGGACGCCTGGGAA[C/T]AAACTGTAAAGACCCAGAAGAAAGAACATGGGCGTCTGAACAGAGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 371 1225 8 28
ENSDART00000125164 Nonsense 368 1236 8 29
Genomic Location:
Chromosome 25 (position 16933371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAATAAWAGGGCAATGTTAAGCTGATGTTATATTATGTTTGTCTGTG[C/T]AGTTGGAGCGTTATAAGGAACTCAAAGAGTTAGCTAGAAGGAACGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 496 1225 10 28
ENSDART00000125164 Nonsense 500 1236 11 29
Genomic Location:
Chromosome 25 (position 16932156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGCTGACCAAGCTGCAGAACGCCCGTCTGGACAGCCAAGAGAACCGA[C/T]GACAGCAGAAACGAGACGAAGTGCTGGAAAGCCTCAGGAGACTCTACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Nonsense 551 1225 11 28
ENSDART00000125164 Nonsense 555 1236 12 29
Genomic Location:
Chromosome 25 (position 16928993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGTGTTTGGCAAGAACATGAACGCTATCGTTGTGACGTCTGCTTA[T/A]GTGGCCCATGATTGCATTCGATATCTGAAAGAGGAAAGAGCCGAACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Essential Splice Site 577 1225 11 28
ENSDART00000125164 Essential Splice Site 581 1236 12 29
Genomic Location:
Chromosome 25 (position 16928913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAAGAGCCGAACCAGAGACTTTTCTTCCTATTGACTATATAGATG[T/A]GAGTGAAACATCAAGGTCTTTCTCAAATCATTATTCTTTTTTTATTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027320 Essential Splice Site 992 1225 22 28
ENSDART00000125164 Essential Splice Site 999 1236 23 29
Genomic Location:
Chromosome 25 (position 16919544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCGCAGATGGTGTTTGATTTTTCTGCATTGGACAACAGCCTTAAGG[T/C]AGAATTTGAGGTCTMTCTCAGATTCATTCTTATGTTGTTGAAGTGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link