si:dkey-14d8.2

Ensembl ID:
ENSDARG00000014395
ZFIN ID:
ZDB-GENE-041210-110
Description:
hypothetical protein LOC558542 [Source:RefSeq peptide;Acc:NP_001038333]
Human Orthologue:
RP3-402G11.5
Human Description:
Selenoprotein O [Source:UniProtKB/Swiss-Prot;Acc:Q9BVL4]
Mouse Orthologue:
1300018J18Rik
Mouse Description:
RIKEN cDNA 1300018J18 gene Gene [Source:MGI Symbol;Acc:MGI:1919007]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25273 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044365 Nonsense 51 692 1 9
ENSDART00000103219 Nonsense 33 612 1 8
Genomic Location (Zv9):
Chromosome 4 (position 5251822)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5370003
KASP Assay ID:
554-7687.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCAAAGTTTAACTCCTCTGGAAAGACTGAAGTTCAATAACGTTGCTT[T/G]AAAAGCACTGCCAGTGGATTCATCTCTAGAACCGGGCTCAAGGACGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link