si:ch211-236p22.1

Ensembl ID:
ENSDARG00000014391
ZFIN ID:
ZDB-GENE-050419-118
Description:
Novel sushi domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LVL7]
Human Orthologue:
CSMD3
Human Description:
CUB and Sushi multiple domains 3 [Source:HGNC Symbol;Acc:19291]
Mouse Orthologue:
Csmd3
Mouse Description:
CUB and Sushi multiple domains 3 Gene [Source:MGI Symbol;Acc:MGI:2386403]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42822 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42821 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17497 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074570   None 353 None 9
ENSDART00000143582 Essential Splice Site 58 429 1 10
Genomic Location (Zv9):
Chromosome 16 (position 50774849)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47628924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTGCCAAGCAGACGCCACATGGAGCGGCACTCAACCACGCTGCATAG[G/A]TATATTTACTTTTAAGAACGTTTTCCTCTTATCAATAAATACTTTATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074570 Essential Splice Site 16 353 1 9
ENSDART00000143582 Essential Splice Site 83 429 2 10
Genomic Location (Zv9):
Chromosome 16 (position 50771505)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47625580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTGGCACTCCAGAATTCGGCTCTTTGAACAGCAGTCTGGGCTTTAAG[G/A]TAAGAAGCAGTGGAGCTTGGACTGTCTTGGCCTCTTATATCAAAGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074570 Nonsense 41 353 2 9
ENSDART00000143582 Nonsense 108 429 3 10
Genomic Location (Zv9):
Chromosome 16 (position 50765159)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47619234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTCAGACGGGCCACTTGTTACTGGGCTCCACCACACGCACRTGTCAG[C/T]AGGATTTGACCTGGAGTGGCTCTCAACCTGAATGCATCCGTGAGTCTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link