chek1

Ensembl ID:
ENSDARG00000014385
ZFIN ID:
ZDB-GENE-040426-896
Description:
serine/threonine-protein kinase Chk1 [Source:RefSeq peptide;Acc:NP_956487]
Human Orthologue:
CHEK1
Human Description:
CHK1 checkpoint homolog (S. pombe) [Source:HGNC Symbol;Acc:1925]
Mouse Orthologue:
Chek1
Mouse Description:
checkpoint kinase 1 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1202065]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25158 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065538 Nonsense 384 410 11 11
ENSDART00000101776 Nonsense 433 459 12 12
ENSDART00000137423 Nonsense 384 410 12 12
ENSDART00000138666 None None 226 None 9
ENSDART00000145977 None None 351 None 10
Genomic Location:
Chromosome 21 (position 21679818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAACTGATTTGATTAAAGCTCTGTTTTTTGTATTCTAGGGGGATGGTT[T/A]GGAATTCAAGCGAATATTCCTGAAACTCAAACAGAAGCTGTCTGACATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dhady67u