im:7162646

Ensembl ID:
ENSDARG00000014378
ZFIN ID:
ZDB-GENE-090218-27
Description:
LOC562826 protein [Source:UniProtKB/TrEMBL;Acc:Q4VBH0]
Human Orthologue:
SLC12A4
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 4 [Source:HGNC Symbol;Acc:10913]
Mouse Orthologue:
Slc12a4
Mouse Description:
solute carrier family 12, member 4 Gene [Source:MGI Symbol;Acc:MGI:1309465]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11950 Nonsense Available for shipment Available now
sa18878 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Nonsense 646 1095 15 24
ENSDART00000005053 Nonsense 646 1095 15 24
Genomic Location (Zv9):
Chromosome 7 (position 36749538)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35023381
KASP Assay ID:
554-6141.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGCATGAGTAYGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Nonsense 646 1095 15 24
ENSDART00000005053 Nonsense 646 1095 15 24
Genomic Location (Zv9):
Chromosome 7 (position 36749538)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35023381
KASP Assay ID:
554-6141.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGCATGAGTATGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link