im:7162646

Ensembl ID:
ENSDARG00000014378
ZFIN ID:
ZDB-GENE-090218-27
Description:
LOC562826 protein [Source:UniProtKB/TrEMBL;Acc:Q4VBH0]
Human Orthologue:
SLC12A4
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 4 [Source:HGNC Symbol;Acc:10913]
Mouse Orthologue:
Slc12a4
Mouse Description:
solute carrier family 12, member 4 Gene [Source:MGI Symbol;Acc:MGI:1309465]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8274 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11950 Nonsense Available for shipment Available now
sa18878 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Essential Splice Site 234 1095 6 24
Genomic Location:
Chromosome 7 (position 36755790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCTTCGCTGCTGCCATGTACATATTGGGAGCAATTGAAATATTTCTG[G/T]TCAGTCTTCTTTTATTWTAATCACACACAAAGCATGATCTAAWCTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Nonsense 646 1095 15 24
ENSDART00000005053 Nonsense 646 1095 15 24
Genomic Location:
Chromosome 7 (position 36749538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGCATGAGTAYGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Nonsense 646 1095 15 24
ENSDART00000005053 Nonsense 646 1095 15 24
Genomic Location:
Chromosome 7 (position 36749538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGCATGAGTATGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3vit5u8l