amh

Ensembl ID:
ENSDARG00000014357
ZFIN ID:
ZDB-GENE-050706-192
Description:
muellerian-inhibiting factor [Source:RefSeq peptide;Acc:NP_001007780]
Human Orthologue:
AMH
Human Description:
anti-Mullerian hormone [Source:HGNC Symbol;Acc:464]
Mouse Orthologue:
Amh
Mouse Description:
anti-Mullerian hormone Gene [Source:MGI Symbol;Acc:MGI:88006]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24159 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013803 Nonsense 75 549 2 7
Genomic Location:
Chromosome 22 (position 21079800)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCAACTGACCAATATGCCACTGAAGACACACCATTCAATAAAGAACAA[A/T]AAACACTGAATGAGTTCCTGTCAGCCCTGAAAAGTGCTGGGGAACTGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mpke71ap