npm1

Ensembl ID:
ENSDARG00000014329
ZFIN ID:
ZDB-GENE-021028-1
Description:
nucleophosmin [Source:RefSeq peptide;Acc:NP_955460]
Human Orthologue:
NPM1
Human Description:
nucleophosmin (nucleolar phosphoprotein B23, numatrin) [Source:HGNC Symbol;Acc:7910]
Mouse Orthologues:
AC154357.1, Npm1
Mouse Description:
nucleophosmin 1 Gene [Source:MGI Symbol;Acc:MGI:106184]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8446 Nonsense Mutation detected in F1 DNA During 2017
sa8620 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021240 Nonsense 217 279 9 11
ENSDART00000100526 Nonsense 219 281 10 12
ENSDART00000129634 Nonsense 221 283 11 13
ENSDART00000133304 Nonsense 217 279 9 11
ENSDART00000134189 Nonsense 152 214 8 10
ENSDART00000021240 Nonsense 217 279 9 11
ENSDART00000100526 Nonsense 219 281 10 12
ENSDART00000129634 Nonsense 221 283 11 13
ENSDART00000133304 Nonsense 217 279 9 11
ENSDART00000134189 Nonsense 152 214 8 10

The following transcripts of ENSDARG00000014329 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 22241743)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22072081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAAATGATGTTTTATGGAAACAGACTCCACAAAAGGGCAAGAARGAA[C/T]AGACACCCAAAAYGCCACAAACACCACGGACTTTAGCCGATATCAAGKCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021240 Nonsense 217 279 9 11
ENSDART00000100526 Nonsense 219 281 10 12
ENSDART00000129634 Nonsense 221 283 11 13
ENSDART00000133304 Nonsense 217 279 9 11
ENSDART00000134189 Nonsense 152 214 8 10
ENSDART00000021240 Nonsense 217 279 9 11
ENSDART00000100526 Nonsense 219 281 10 12
ENSDART00000129634 Nonsense 221 283 11 13
ENSDART00000133304 Nonsense 217 279 9 11
ENSDART00000134189 Nonsense 152 214 8 10

The following transcripts of ENSDARG00000014329 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 22241743)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22072081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAAATGATGTTTTATGGAAACAGACTCCACAAAAGGGCAAGAARGAA[C/T]AGACACCCAAAAYGCCACAAACACCACGGACTTTAGCCGATATCAAGKCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link