sh2d5

Ensembl ID:
ENSDARG00000014324
ZFIN ID:
ZDB-GENE-050327-67
Description:
SH2 domain containing 5 (sh2d5), mRNA [Source:RefSeq DNA;Acc:NM_001014343]
Human Orthologue:
SH2D5
Human Description:
SH2 domain containing 5 [Source:HGNC Symbol;Acc:28819]
Mouse Orthologue:
Sh2d5
Mouse Description:
SH2 domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2446215]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10504 Nonsense Available for shipment Available now
sa41899 Missense Mutation detected in F1 DNA During 2017
sa35146 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131782 Nonsense 8 410 2 10
ENSDART00000140502 Nonsense 8 149 2 5

The following transcripts of ENSDARG00000014324 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 38807790)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37374809
KASP Assay ID:
2260-4597.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGTTGACCACCTTTTATATTTATGAACAGTAGAAAAGGCAAACACCA[C/T]AACCAGGTTCAGTTTGGAACATGGGTGAAACAGCTGGAAGAGAGCATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131782 Missense 292 410 8 10
ENSDART00000140502   None 149 None 5

The following transcripts of ENSDARG00000014324 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 38814969)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37381988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGGCCGAAACAGAAGAAGCACTGGCTCAAGCTGTGTGGTGTTGGGCT[G/A]GCGTGTCTAGGTCAGTATTAGTGCACAATGACTTTGACGTCTGTTGTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131782 Nonsense 297 410 9 10
ENSDART00000140502   None 149 None 5

The following transcripts of ENSDARG00000014324 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 38815655)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37382674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAAAAAATCTTTGTGTTGAGTATTTGGTGTTTCCATTACAGTGACTG[T/A]AGCTCCTCACTGCTGGCAGATGATGTTTTGGGTGCTTTCCTTCTCTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link