si:ch211-163m16.1

Ensembl ID:
ENSDARG00000014320
ZFIN ID:
ZDB-GENE-091118-67
Human Orthologue:
GUCY2C
Human Description:
guanylate cyclase 2C (heat stable enterotoxin receptor) [Source:HGNC Symbol;Acc:4688]
Mouse Orthologue:
Gucy2c
Mouse Description:
guanylate cyclase 2c Gene [Source:MGI Symbol;Acc:MGI:106903]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31310 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058171 Nonsense 344 648 11 17
ENSDART00000144120 Nonsense 204 476 6 12
Genomic Location (Zv9):
Chromosome 3 (position 4303457)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4083116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATGCCAGCTACATGGATAACCTGATCCGCCGACTGCAGATGTACTCC[A/T]GAAACCTGGAGCACCTGGTGGAGGAGAGAACCGCTCTGTACAAGGCGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link