athl1

Ensembl ID:
ENSDARG00000014311
ZFIN ID:
ZDB-GENE-061103-319
Description:
Acid trehalase-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A0JMP0]
Human Orthologue:
ATHL1
Human Description:
ATH1, acid trehalase-like 1 (yeast) [Source:HGNC Symbol;Acc:26210]
Mouse Orthologue:
Athl1
Mouse Description:
ATH1, acid trehalase-like 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444047]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8052 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021120 Nonsense 150 655 4 14
Genomic Location:
Chromosome 25 (position 5208362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTGGACGCCAGTCACACCCACTCTCACACTCCCGGCCAATCAGAGC[C/T]AGTCCAGCTGGACTTTCCTAGTTGCTGTTGCTAGGAGCAAYGAAAGCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cqwhrvvz