med15

Ensembl ID:
ENSDARG00000014292
ZFIN ID:
ZDB-GENE-040426-2032
Description:
Mediator of RNA polymerase II transcription subunit 15 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVN7]
Human Orthologue:
MED15
Human Description:
mediator complex subunit 15 [Source:HGNC Symbol;Acc:14248]
Mouse Orthologues:
A230006K03Rik, AC129019.1, AL606965.1, Glrp1, Med15
Mouse Descriptions:
glutamine repeat protein 1 Gene [Source:MGI Symbol;Acc:MGI:108038]
mediator complex subunit 15 Gene [Source:MGI Symbol;Acc:MGI:2137379]
RIKEN cDNA A230006K03 gene Gene [Source:MGI Symbol;Acc:MGI:3644205]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17487 Essential Splice Site Available for shipment Available now
sa23898 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021997 None 36 802 2 18
ENSDART00000139622 Essential Splice Site 23 48 2 6
ENSDART00000140129 None None 138 None 3
Genomic Location:
Chromosome 21 (position 17760327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAATTACAGTGAGGAAGCCATGAGAAAAGCAGGAACTGGTCACACAAA[G/A]TCCAGTACTGAGATGGAGAGCCATGTTTTTACGAAAGCAAAGACCAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021997 Essential Splice Site 69 802 3 18
ENSDART00000139622 Essential Splice Site None 48 3 6
ENSDART00000140129 None None 138 None 3
Genomic Location:
Chromosome 21 (position 17760115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTATTTATCAATGGTTGCGAGGCTGATAATTCACTTTAGAGACATCC[G/A]TAAGTAACCAACACAGATTTCAATATAAATGTTTTTGCATTGTTGTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dfvpx3dk