eno2

Ensembl ID:
ENSDARG00000014287
ZFIN ID:
ZDB-GENE-040704-27
Description:
gamma-enolase [Source:RefSeq peptide;Acc:NP_001003848]
Human Orthologue:
ENO2
Human Description:
enolase 2 (gamma, neuronal) [Source:HGNC Symbol;Acc:3353]
Mouse Orthologue:
Eno2
Mouse Description:
enolase 2, gamma neuronal Gene [Source:MGI Symbol;Acc:MGI:95394]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23423 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037126 Essential Splice Site 222 434 7 12
ENSDART00000141559 Essential Splice Site 222 413 7 12
Genomic Location:
Chromosome 19 (position 5706411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGGGGATGAGGGAGGTTTCGCGCCAAATATCCTGGAGAACAGTGAAG[G/A]TGGGGTGTGAAATGATTTATGCTGCTGTTGTAGTTGTTAAATAAGGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tno3eeav