camk2d2

Ensembl ID:
ENSDARG00000014273
ZFIN IDs:
ZDB-GENE-040718-277, ZDB-GENE-040718-277
Description:
Calcium/calmodulin-dependent protein kinase type II delta 2 chain [Source:UniProtKB/Swiss-Prot;Acc:Q
Human Orthologue:
CAMK2D
Human Description:
calcium/calmodulin-dependent protein kinase II delta [Source:HGNC Symbol;Acc:1462]
Mouse Orthologue:
Camk2d
Mouse Description:
calcium/calmodulin-dependent protein kinase II, delta Gene [Source:MGI Symbol;Acc:MGI:1341265]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2005 Essential Splice Site F2 line generated During 2016
sa32622 Essential Splice Site Available for shipment Available now
sa19450 Nonsense Available for shipment Available now
sa25543 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2005
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040049 Essential Splice Site 199 493 8 19
ENSDART00000044896 Essential Splice Site 199 554 8 22
ENSDART00000040049 Essential Splice Site 199 493 8 19
ENSDART00000044896 Essential Splice Site 199 554 8 22
Genomic Location (Zv9):
Chromosome 1 (position 13078251)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13506993
KASP Assay ID:
554-3243.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCTGAGGAAAGATCCTTATGGCAAACCGGTGGACATGTGGGCTTGCG[G/A]TAAGAAATGAWTGAGCCACAGAAATATCAGCTTTATAAGTGAGCCGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040049 Essential Splice Site 272 493 10 19
ENSDART00000044896 Essential Splice Site 272 554 10 22
Genomic Location (Zv9):
Chromosome 1 (position 13076051)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13504793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAAACGTATCACAGCTGCTGAAGCCCTCAAACACCCCTGGATCTGCG[T/G]ATGTTTTTTTAACACATAAACACACACTAGTAAACAAGCTTGTCTATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040049 Nonsense 296 493 11 19
ENSDART00000044896 Nonsense 296 554 11 22
Genomic Location (Zv9):
Chromosome 1 (position 13075862)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13504604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGATGCACAGACAGGAAACCGTGGAGTGCTTGAAGAAATTCAACGCC[A/T]GAAGGAAACTCAAGGTTAGTTTTTAACTGATCTTTTACAGTTTTCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040049 Essential Splice Site 343 493 14 19
ENSDART00000044896 Essential Splice Site 363 554 15 22
Genomic Location (Zv9):
Chromosome 1 (position 13063294)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13492036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGGAGCCACAAACTACCGTGATCCACAACCCAGTGGACAGAAACAAG[G/A]TAATGTTCATTGTTAAAATCCAACTGAAGCCAATATCAGAGTTTTTGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link