eya1

Ensembl ID:
ENSDARG00000014259
ZFIN ID:
ZDB-GENE-990712-18
Description:
eyes absent homolog 1 [Source:RefSeq peptide;Acc:NP_571268]
Human Orthologue:
EYA1
Human Description:
eyes absent homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3519]
Mouse Orthologue:
Eya1
Mouse Description:
eyes absent 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109344]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3273 Essential Splice Site F2 line generated During 2014
sa11723 Nonsense Available for shipment Available now
sa10957 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3273
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012253 Essential Splice Site 139 587 5 17
ENSDART00000081595 Essential Splice Site 161 609 6 19
ENSDART00000134221 Essential Splice Site 139 592 5 17
ENSDART00000136443 Essential Splice Site 161 609 6 18
ENSDART00000142058 None None 86 None 4

The following transcripts of ENSDARG00000014259 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 13852962)
KASP Assay ID:
554-3177.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGCACATACCCTCAGCCAGGCCAGCCGTACGGGATTTCTGCCTATGG[T/C]AACCAATTCTTCCTAATGCRTTAAAGCTTTGCAATTTTGGTTGTGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012253 Nonsense 344 587 10 17
ENSDART00000081595 Nonsense 366 609 11 19
ENSDART00000134221 Nonsense 349 592 10 17
ENSDART00000136443 Nonsense 366 609 11 18
ENSDART00000142058 None None 86 None 4

The following transcripts of ENSDARG00000014259 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 13875949)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCATCGTTTTCCATTCCTTGCTCACAGGATCTTACGYCAACCGATTC[G/T]GAAGGGTAAGTCGTGTATTTTAAATGCAAACACAGGYAAATATTGCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012253 Nonsense 420 587 13 17
ENSDART00000081595 Nonsense 442 609 14 19
ENSDART00000134221 Nonsense 425 592 13 17
ENSDART00000136443 Nonsense 442 609 14 18
ENSDART00000142058 None None 86 None 4

The following transcripts of ENSDARG00000014259 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 13910278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCACGCTGCTGCCACCAGTGCCAAYCTGTGTCTGGCCACCGGYGTA[C/T]GAGGAGGCGTGGACTGGATGAGAAAGCTCGCGTTCCGCTACAGACGAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jjgomv2p