JAG2 (2 of 2)

Ensembl ID:
ENSDARG00000014246
Description:
jagged 2 [Source:HGNC Symbol;Acc:6189]
Human Orthologue:
JAG2
Human Description:
jagged 2 [Source:HGNC Symbol;Acc:6189]
Mouse Orthologue:
Jag2
Mouse Description:
jagged 2 Gene [Source:MGI Symbol;Acc:MGI:1098270]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22342 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11543 Essential Splice Site Available for shipment Available now
sa6320 Nonsense Mutation detected in F1 DNA During 2014
sa10076 Nonsense Available for shipment Available now
sa13426 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025007 Essential Splice Site 232 1136 6 29
Genomic Location:
Chromosome 13 (position 33745537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGTCTGTTCGTTAGAGTAAAATTGTTCCACACACACATCACACACA[T/G]TTGACGGCATGCATGTCAGCTTTAAATAGTAGTGAATGAGCTGAGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025007 Essential Splice Site 273 1136 7 29
Genomic Location:
Chromosome 13 (position 33746802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGACGTGCACCTRTGAGAAAAATTGGGGTGGACTTCTGTGTGACAAAG[G/A]TARGTGATACTTTTAAGTAACYACAGATGCAATTAACTGRATAAATRAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025007 Nonsense 301 1136 8 29
Genomic Location:
Chromosome 13 (position 33748865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAATGGAGGCACGTGTTTGAATACAGAGCCGGATGAATATTTCTGCT[T/A]GTGCCCTGAGGGMTATTCTGGTGAAAACTGCCATATCTGTAAGAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025007 Nonsense 538 1136 15 29
Genomic Location:
Chromosome 13 (position 33757995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACTGYGCCTGTGCTGATGAATRCGAGGGGAAGACATGCAGTCAGCTA[C/T]GAGACCACTGCAAGACCAGCACGTGCCATGGTAGACTACTTCCTATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025007 Essential Splice Site 956 1136 25 29
Genomic Location:
Chromosome 13 (position 33767490)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACTGTGCTCKTGTTACACTTGTATTTGACTCWGACACTGTACCGCAG[G/A]TAAGAGGTTTTCATTTAATTTGTTTTATGCATTTAAAAGAGGTGAAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e4djq93g