Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rbmx
- Ensembl ID:
- ENSDARG00000014244
- ZFIN ID:
- ZDB-GENE-030131-579
- Description:
- heterogeneous nuclear ribonucleoprotein G [Source:RefSeq peptide;Acc:NP_997763]
- Human Orthologues:
- RBMX, RBMXL1, RBMXL2, RBMXL3, RBMY1A1, RBMY1B, RBMY1D, RBMY1E, RBMY1F, RBMY1J
- Human Descriptions:
- RNA binding motif protein, X-linked [Source:HGNC Symbol;Acc:9910]
- RNA binding motif protein, X-linked-like 1 [Source:HGNC Symbol;Acc:25073]
- RNA binding motif protein, X-linked-like 2 [Source:HGNC Symbol;Acc:17886]
- RNA binding motif protein, X-linked-like 3 [Source:HGNC Symbol;Acc:26859]
- RNA binding motif protein, Y-linked, family 1, member A1 [Source:HGNC Symbol;Acc:9912]
- RNA binding motif protein, Y-linked, family 1, member B [Source:HGNC Symbol;Acc:23914]
- RNA binding motif protein, Y-linked, family 1, member D [Source:HGNC Symbol;Acc:23915]
- RNA binding motif protein, Y-linked, family 1, member E [Source:HGNC Symbol;Acc:23916]
- RNA binding motif protein, Y-linked, family 1, member F [Source:HGNC Symbol;Acc:23974]
- RNA binding motif protein, Y-linked, family 1, member J [Source:HGNC Symbol;Acc:23917]
- Mouse Orthologues:
- AC132601.1, AC163691.1, Gm10256, Gm10352, Rbmx, Rbmxl2, Rbmxrt, Rbmy1a1
- Mouse Descriptions:
- predicted gene 10256 Gene [Source:MGI Symbol;Acc:MGI:3710530]
- predicted gene 10352 Gene [Source:MGI Symbol;Acc:MGI:3708825]
- RNA binding motif protein, X chromosome Gene [Source:MGI Symbol;Acc:MGI:1343044]
- RNA binding motif protein, X chromosome retrogene Gene [Source:MGI Symbol;Acc:MGI:1343045]
- RNA binding motif protein, X-linked-like 2 Gene [Source:MGI Symbol;Acc:MGI:1923822]
- RNA binding motif protein, Y chromosome, family 1, member A1 Gene [Source:MGI Symbol;Acc:MGI:104732]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa22508 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22508
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007927 | Nonsense | 172 | 379 | 6 | 9 |
| ENSDART00000128730 | Nonsense | 167 | 374 | 6 | 9 |
| ENSDART00000131024 | Nonsense | 172 | 277 | 6 | 10 |
The following transcripts of ENSDARG00000014244 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 14 (position 32729990)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 31519797 GRCz11 14 31860111 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAATCCTTAATGTTAACATTTTGCACAGCGTCCAGAGACCGGGATCCATA[T/A]GGCCCCCCTCCACGCAGAGATTCTCTTATGTCACGGCGGGATGATGGTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
