esyt1b

Ensembl ID:
ENSDARG00000014239
ZFIN ID:
ZDB-GENE-040724-209
Description:
Novel protein similar to mouse and human membrane bound C2 domain containing protein (MBC2) [Source:
Human Orthologue:
ESYT1
Human Description:
extended synaptotagmin-like protein 1 [Source:HGNC Symbol;Acc:29534]
Mouse Orthologue:
Esyt1
Mouse Description:
extended synaptotagmin-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344426]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13012 Nonsense Available for shipment Available now
sa10630 Nonsense Available for shipment Available now
sa20822 Nonsense Mutation detected in F1 DNA During 2014
sa1525 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa13012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014819 Nonsense 317 1032 9 35
ENSDART00000140223 None None 314 None 10
ENSDART00000144174 Nonsense 352 1076 9 31
Genomic Location:
Chromosome 6 (position 52235795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGATGGCCGGCATGTCTGACCCGTACGCCATTGTCCGAGTCGGACCA[C/T]AAACCTTSAAATCCCATCACCTGGACAACACKCTCAGTCCCAAATGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014819 Nonsense 746 1032 23 35
ENSDART00000140223 None None 314 None 10
ENSDART00000144174 Nonsense 705 1076 20 31
Genomic Location:
Chromosome 6 (position 52263496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAGTGCCGTCTGCAGCTCTCCTGTTTKTGTATGTGGAGCAAGCATAT[G/T]AGCTTCCTGTGAGTATTAACACTAATGTTAGCTCTTTAAWTAGCTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014819 None None 1032 None 35
ENSDART00000140223 None None 314 None 10
ENSDART00000144174 Nonsense 840 1076 24 31
Genomic Location:
Chromosome 6 (position 52269026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAAGGATGGTCTGATGGGTGGGATGGTGAAGGGGAAAAGTGACCCGTA[T/A]GTTAAGATCCACATCGGTGACACAACATTTAAGAGTCACGTAATCAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1525
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014819 Essential Splice Site 934 1032 32 35
ENSDART00000140223 Essential Splice Site 217 314 7 10
ENSDART00000144174 None None 1076 None 31
Genomic Location:
Chromosome 6 (position 52284657)
KASP Assay ID:
554-1449.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCATGTCCTTCCAGAAGAAGCTGACGCTGCTCGTCCACAACTGCAGG[T/A]CTGAGCTACACTCATGACGAGTTNNTGAGTTATCTCTGTNNGTGTGAAGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Systemic sclerosis: Identification of novel genetic markers associated with clinical phenotypes of systemic sclerosis through a genome-wide association strategy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oqew01cq