si:dkey-121j17.5

Ensembl ID:
ENSDARG00000014232
ZFIN ID:
ZDB-GENE-030131-4745
Description:
Novel protein similar to vertebrate protein kinase, cGMP-dependent, type I (PRKG1) [Source:UniProtKB
Human Orthologues:
PRKG1, PRKG2
Human Descriptions:
protein kinase, cGMP-dependent, type I [Source:HGNC Symbol;Acc:9414]
protein kinase, cGMP-dependent, type II [Source:HGNC Symbol;Acc:9416]
Mouse Orthologues:
Prkg1, Prkg2
Mouse Descriptions:
protein kinase, cGMP-dependent, type I Gene [Source:MGI Symbol;Acc:MGI:108174]
protein kinase, cGMP-dependent, type II Gene [Source:MGI Symbol;Acc:MGI:108173]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10460 Nonsense Available for shipment Available now
sa16085 Nonsense Available for shipment Available now
sa5945 Nonsense Mutation detected in F1 DNA During 2017
sa16040 Nonsense Available for shipment Available now
sa44929 Nonsense Mutation detected in F1 DNA During 2017
sa13353 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 72 571 2 17
Genomic Location (Zv9):
Chromosome 20 (position 656109)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGCGGGRGAGCTGAAGGTTACTCAGGCTGGWCGTGATTTGCGTATTT[T/A]GAGCCYTGGAGATATGTTCGGGGAACTGGCCATTCTATACAACTGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 106 571 3 17
Genomic Location (Zv9):
Chromosome 20 (position 655918)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTGTTTTCCCCMCAGCCATYTCTGCGGTAAAGTTATGGYGTATYGWG[A/T]GACAAACGTAWCGGAGCATCATGACCAACWAATCCAAGWTGAAACGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 109 571 3 17
Genomic Location (Zv9):
Chromosome 20 (position 655907)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649182
KASP Assay ID:
554-3878.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACAGCCATCTCTGCGGTAAAGTTATGGTGTATCGAGAGACAAACGTA[T/A]CGGAGCATCATGACCAACAAATCCAAGATGAAACGAGAGCAGCTGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 116 571 3 17
Genomic Location (Zv9):
Chromosome 20 (position 655888)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNGATGGYGTATYGWGWGACAAACGTAWCGGAGCATCATGACCAAC[A/T]AATCCAAGWTGAAACGAGAGCAGCTGATGGGCTTCCTGAAAACGTACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 314 571 10 17
Genomic Location (Zv9):
Chromosome 20 (position 641408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCATGTTGTTGCGAAGAAGCAGGAGGCTCACATTCTGCTGGAAAAG[A/T]AAATTCTCCAGGCTATCCGATGCGATTTCATTGTCAGGTCTGTGTAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 555 571 17 17
Genomic Location (Zv9):
Chromosome 20 (position 633682)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 626957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTCGGTTTTCAGGGTCCTTGCTATWTMAACTTCGACCGYTTTCCTTA[T/G]GACAAGACCCAGGCGGAGGAGGAATTCTCAGGCTGGGATTGTGACTTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Identification of IL6R and chromosome 11q13.5 as risk loci for asthma. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link