dlst

Ensembl ID:
ENSDARG00000014230
ZFIN ID:
ZDB-GENE-030326-1
Description:
dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, m
Human Orthologue:
DLST
Human Description:
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) [Source:HGNC Symbol
Mouse Orthologue:
Dlst
Mouse Description:
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Gene [Source:MGI Sy

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17039 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016614 Essential Splice Site 414 458 14 15

The following transcripts of ENSDARG00000014230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 53077622)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52463189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGGGCATGCAYGGCATCTTCGACCGGCCTGTGGCCATCGCTGGCAAG[G/A]TAAACGCGTCAATGCATTGTGTATTAYTCTAATAGAGATCAGCAGGAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link