mecp2

Ensembl ID:
ENSDARG00000014218
ZFIN ID:
ZDB-GENE-030131-7190
Description:
methyl-CpG-binding protein 2 [Source:RefSeq peptide;Acc:NP_997901]
Human Orthologue:
MECP2
Human Description:
methyl CpG binding protein 2 (Rett syndrome) [Source:HGNC Symbol;Acc:6990]
Mouse Orthologue:
Mecp2
Mouse Description:
methyl CpG binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:99918]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21196 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040672 Nonsense 204 523 3 3
ENSDART00000123882 Nonsense 205 524 3 3
Genomic Location:
Chromosome 8 (position 8154265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACCCTCTGGACGTGGAAGGGGGCGGCCTAAAGGTAGCGGCAAGGTA[C/T]GACAGGCTACAGAAGGGGTGGCGGTGAAACGCGTCATAGAAAAGAGTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jork9h94