si:ch211-122a20.1

Ensembl ID:
ENSDARG00000014215
ZFIN ID:
ZDB-GENE-060503-286
Description:
Novel protein similar to vertebrate cadherin 13, H-cadherin (Heart) (CDH13) [Source:UniProtKB/TrEMBL
Human Orthologue:
CDH13
Human Description:
cadherin 13, H-cadherin (heart) [Source:HGNC Symbol;Acc:1753]
Mouse Orthologue:
Cdh13
Mouse Description:
cadherin 13 Gene [Source:MGI Symbol;Acc:MGI:99551]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23253 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099594 Nonsense 532 620 10 12
ENSDART00000136754 Nonsense 573 661 10 12
Genomic Location (Zv9):
Chromosome 18 (position 13599089)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14142017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGGACATTCGTCCTAATACAGATCCTTTCAAGATTGAGCTCGGCAAA[C/T]AGCCAGGACTAGAGAAAACATGGAAGATCTCCAGGATCAATGGTAAGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link