foxp1b

Ensembl ID:
ENSDARG00000014181
ZFIN ID:
ZDB-GENE-041203-1
Description:
Forkhead box protein P1-B [Source:UniProtKB/Swiss-Prot;Acc:Q2LE08]
Human Orthologue:
FOXP1
Human Description:
forkhead box P1 [Source:HGNC Symbol;Acc:3823]
Mouse Orthologue:
Foxp1
Mouse Description:
forkhead box P1 Gene [Source:MGI Symbol;Acc:MGI:1914004]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16567 Nonsense Available for shipment Available now
sa40774 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20798 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064938 Nonsense 124 659 7 20
ENSDART00000128174 Nonsense 124 660 3 16
Genomic Location (Zv9):
Chromosome 6 (position 43594561)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43665725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCAAGTCCTGAGCCCTCAGCAGCTCCAGCTGTTACTGCAGCAACAA[C/T]AAGCACTGATGTTACAGCAGGTATACTCGCTCTCGTTCTGCTTTACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064938 Essential Splice Site 208 659 9 20
ENSDART00000128174 Essential Splice Site 209 660 5 16
Genomic Location (Zv9):
Chromosome 6 (position 43586882)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43658046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCCATCCAGCCCAACCAGACTCTGCCTCTGCACACCCTTACTCAGGG[T/A]AAGAGCAGGCACAGCCGTCGACTTTTATTCACACACACACACACACATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064938 Essential Splice Site 493 659 16 20
ENSDART00000128174 Essential Splice Site 494 660 12 16
Genomic Location (Zv9):
Chromosome 6 (position 43546073)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43617237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCACGCGAATGTTTGCATATTTCAGACGCAACGCAGCAACGTGGAAG[G/A]TGAGCTCACGATTATGGTTTTATATGTATATTTGTAATTATATCCAATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Inattentive symptoms: Genome-wide association scan of quantitative traits for attention deficit hyperactivity disorder identifies novel associations and confirms candidate gene associations. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link