ildr2

Ensembl ID:
ENSDARG00000014180
ZFIN ID:
ZDB-GENE-050706-83
Description:
immunoglobulin-like domain-containing receptor 2 [Source:RefSeq peptide;Acc:NP_001025363]
Human Orthologue:
ILDR2
Human Description:
immunoglobulin-like domain containing receptor 2 [Source:HGNC Symbol;Acc:18131]
Mouse Orthologue:
Ildr2
Mouse Description:
immunoglobulin-like domain containing receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1196370]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18952 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17518 Nonsense Available for shipment Available now
sa15399 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049805 Essential Splice Site 184 590 4 9
ENSDART00000125451 Essential Splice Site 169 602 3 8
Genomic Location:
Chromosome 9 (position 35258039)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGTGCTGGATGACATCCTGCCTGAGTTTGATTTGGAGATTATGCCAG[G/T]TACGCCTGCCATACCTCTTTCTCTCTCTCTCTCTTTCTCTCTTCCCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049805 Nonsense 343 590 7 9
ENSDART00000125451 Nonsense 366 602 7 8
Genomic Location:
Chromosome 9 (position 35250836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACCTAGATGAGCCGCGACTCCGAACAGCATCGATTGGCCAYGGGCTT[C/T]GACCCTCACATTATCAGAGCGATCACTCTCTGGATGAGCATGACAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049805 Nonsense 436 590 8 9
ENSDART00000125451 Nonsense 459 602 8 8
Genomic Location:
Chromosome 9 (position 35249016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATACCGTAATGGGCCTCGCTACCYWCGTGAGGATGATGAYAGTGACTG[G/A]CRTCGTCGAGGTTCGCCACCTTCCCCACCAAAAAGACGCRWTACCGCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xncr3qid