bloc1s1

Ensembl ID:
ENSDARG00000014171
ZFIN ID:
ZDB-GENE-050208-569
Description:
hypothetical protein LOC556597 [Source:RefSeq peptide;Acc:NP_001037815]
Human Orthologue:
BLOC1S1
Human Description:
biogenesis of lysosomal organelles complex-1, subunit 1 [Source:HGNC Symbol;Acc:4200]
Mouse Orthologue:
Bloc1s1
Mouse Description:
biogenesis of lysosome-related organelles complex-1, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:11952

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43772 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013835 Nonsense 102 125 4 4
Genomic Location (Zv9):
Chromosome 22 (position 10234138)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10094306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATCTGTTATAGGAAATCGGAGACGTGGAGAATTGGGCGCGCAGTATC[G/T]AGATGGACATGCGGACGATTGCCACAGCTCTGGAGTATGTGCATAAAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link