LOC559637

Ensembl ID:
ENSDARG00000014169
Human Orthologue:
SYT2
Human Description:
synaptotagmin II [Source:HGNC Symbol;Acc:11510]
Mouse Orthologue:
Syt2
Mouse Description:
synaptotagmin II Gene [Source:MGI Symbol;Acc:MGI:99666]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40803 Nonsense Mutation detected in F1 DNA During 2016
sa33981 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023562 Nonsense 198 433 4 8
Genomic Location (Zv9):
Chromosome 6 (position 55162946)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55179259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGAGGAACGTCTGACCCTTATGTTAAAGTCTTCATTCTACCAGAT[A/T]AGAAGAAAAAGTACGACACCAAGGTGCACAAAAAGACCCTCAACCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023562 Nonsense 202 433 4 8
Genomic Location (Zv9):
Chromosome 6 (position 55162960)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55179273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGACCCTTATGTTAAAGTCTTCATTCTACCAGATAAGAAGAAAAAGTA[C/A]GACACCAAGGTGCACAAAAAGACCCTCAACCCAGTGTTCAATGAATCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link