LOC559637

Ensembl ID:
ENSDARG00000014169
Human Orthologue:
SYT2
Human Description:
synaptotagmin II [Source:HGNC Symbol;Acc:11510]
Mouse Orthologue:
Syt2
Mouse Description:
synaptotagmin II Gene [Source:MGI Symbol;Acc:MGI:99666]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40803 Nonsense Mutation detected in F1 DNA During 2016
sa33981 Nonsense Mutation detected in F1 DNA During 2016
sa5391 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023562 Nonsense 198 433 4 8
Genomic Location:
Chromosome 6 (position 55162946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGAGGAACGTCTGACCCTTATGTTAAAGTCTTCATTCTACCAGAT[A/T]AGAAGAAAAAGTACGACACCAAGGTGCACAAAAAGACCCTCAACCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023562 Nonsense 202 433 4 8
Genomic Location:
Chromosome 6 (position 55162960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGACCCTTATGTTAAAGTCTTCATTCTACCAGATAAGAAGAAAAAGTA[C/A]GACACCAAGGTGCACAAAAAGACCCTCAACCCAGTGTTCAATGAATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023562 Nonsense 238 433 5 8
Genomic Location:
Chromosome 6 (position 55166549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGATCCCGTACCAGGAGCTGGGTGGGAAGACRCTGGTSATGTCTGTGTA[T/A]GATTATGACCGATTCTCCAAACACGACATCATAGGTGAGGTGAAATTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link