ercc4

Ensembl ID:
ENSDARG00000014161
ZFIN ID:
ZDB-GENE-030131-5533
Description:
DNA repair endonuclease XPF [Source:RefSeq peptide;Acc:NP_956079]
Human Orthologue:
ERCC4
Human Description:
excision repair cross-complementing rodent repair deficiency, complementation group 4 [Source:HGNC S
Mouse Orthologue:
Ercc4
Mouse Description:
excision repair cross-complementing rodent repair deficiency, complementation group 4 Gene [Source:M

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35269 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1408 Essential Splice Site Available for shipment Available now
sa42015 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35270 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6249 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015780 Essential Splice Site 185 886 4 12
Genomic Location:
Chromosome 12 (position 21059047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTGTCATGAGAAACTTGTTTGTGAAGAAACTTTTTCTCTGGCCAAGG[T/C]AGGACAACTTCAATCAAGAAAATGTTCACCTTCAAATATTACTAAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015780 Essential Splice Site 315 886 6 12
Genomic Location:
Chromosome 12 (position 21063676)
KASP Assay ID:
554-1329.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGGAGTCTTTGAGAACCAGCCAGAAAAGTTTTGGTAGTAATTCAGG[T/C]ACAGTCCGCTCGTCTGCTGCTTTAGTTGAGATAATTTTACAGCAAAAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015780 Essential Splice Site 606 886 10 12
Genomic Location:
Chromosome 12 (position 21067772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTTACAGCATTAAACAAAGAAAAGCAAGCGTTTGAGCACCTCATAAG[G/A]TTTGTCAAATATATCTCATTTAGCTGAGAAATTCAGTGGAATGTTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015780 Essential Splice Site 606 886 10 12
Genomic Location:
Chromosome 12 (position 21067773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTACAGCATTAAACAAAGAAAAGCAAGCGTTTGAGCACCTCATAAGG[T/G]TTGTCAAATATATCTCATTTAGCTGAGAAATTCAGTGGAATGTTCAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015780 Nonsense 708 886 12 12
Genomic Location:
Chromosome 12 (position 21069931)
KASP Assay ID:
554-5113.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACATCTGCGTAGAGCGCAAAAGCGTCAGCGACCTCATTGGCTCCTTA[C/T]AGAGCGGACGCCTTTAYACACAGTGCCTCTCCATGACTCGATTCTACCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link