ercc4

Ensembl ID:
ENSDARG00000014161
ZFIN ID:
ZDB-GENE-030131-5533
Description:
DNA repair endonuclease XPF [Source:RefSeq peptide;Acc:NP_956079]
Human Orthologue:
ERCC4
Human Description:
excision repair cross-complementing rodent repair deficiency, complementation group 4 [Source:HGNC S
Mouse Orthologue:
Ercc4
Mouse Description:
excision repair cross-complementing rodent repair deficiency, complementation group 4 Gene [Source:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1408 Essential Splice Site Available for shipment Available now
sa6249 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015780 Essential Splice Site 315 886 6 12
Genomic Location:
Chromosome 12 (position 21063676)
KASP Assay ID:
554-1329.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGGAGTCTTTGAGAACCAGCCAGAAAAGTTTTGGTAGTAATTCAGG[T/C]ACAGTCCGCTCGTCTGCTGCTTTAGTTGAGATAATTTTACAGCAAAAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015780 Nonsense 708 886 12 12
Genomic Location:
Chromosome 12 (position 21069931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACATCTGCGTAGAGCGCAAAAGCGTCAGCGACCTCATTGGCTCCTTA[C/T]AGAGCGGACGCCTTTAYACACAGTGCCTCTCCATGACTCGATTCTACCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o3ld2evc