mtdha

Ensembl ID:
ENSDARG00000014159
ZFIN ID:
ZDB-GENE-030616-615
Description:
protein LYRIC [Source:RefSeq peptide;Acc:NP_001007136]
Human Orthologue:
MTDH
Human Description:
metadherin [Source:HGNC Symbol;Acc:29608]
Mouse Orthologue:
Mtdh
Mouse Description:
metadherin Gene [Source:MGI Symbol;Acc:MGI:1914404]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8360 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019136 Nonsense 69 542 1 12
ENSDART00000124246 Nonsense 69 543 1 12
Genomic Location:
Chromosome 19 (position 34289423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCGCGGCGCTGATCGGGCTGCTCTTGCTGGTGGTGCTCGCGGCCTGC[G/T]GACGGAGGAAACGCCGAGCGGCTCCCGTTACCGCGAGTYCTAGAAGCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Migraine: Genome-wide association study of migraine implicates a common susceptibility variant on 8q22.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fzj12e89