med22

Ensembl ID:
ENSDARG00000014148
ZFIN ID:
ZDB-GENE-040625-156
Description:
Mediator of RNA polymerase II transcription subunit 22 [Source:UniProtKB/Swiss-Prot;Acc:A5WUL3]
Human Orthologue:
MED22
Human Description:
mediator complex subunit 22 [Source:HGNC Symbol;Acc:11477]
Mouse Orthologue:
Med22
Mouse Description:
mediator complex subunit 22 Gene [Source:MGI Symbol;Acc:MGI:98446]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5305 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18806 Nonsense Mutation detected in F1 DNA During 2014
sa8193 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014347 None None 203 None 5
ENSDART00000123210 Essential Splice Site None 198 None 5
ENSDART00000125093 None None 140 None 4
ENSDART00000146759 Essential Splice Site None 140 None 4
Genomic Location:
Chromosome 5 (position 34905889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATAAGAACGGGGTGTAAAGCTGTAGATCGCGAATCAACGTTAACGG[T/G]ATGTAACTGCGTGAGAAGATRTATTACTATAGAACAAATTTTGATCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014347 Nonsense 146 203 4 5
ENSDART00000123210 Nonsense 146 198 5 5
ENSDART00000125093 None None 140 None 4
ENSDART00000146759 None None 140 None 4
ENSDART00000014347 Nonsense 146 203 4 5
ENSDART00000123210 Nonsense 146 198 5 5
ENSDART00000125093 None None 140 None 4
ENSDART00000146759 None None 140 None 4
Genomic Location:
Chromosome 5 (position 34912484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAATGTGTGTGTATAACGTTTCTAGCTGTGGACAATGGGATGGTGTT[G/T]AGTTGCCACTTTGTGAGGCCTTTCATCGGCAGGACAGTTGGGGGTCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014347 Nonsense 146 203 4 5
ENSDART00000123210 Nonsense 146 198 5 5
ENSDART00000125093 None None 140 None 4
ENSDART00000146759 None None 140 None 4
ENSDART00000014347 Nonsense 146 203 4 5
ENSDART00000123210 Nonsense 146 198 5 5
ENSDART00000125093 None None 140 None 4
ENSDART00000146759 None None 140 None 4
Genomic Location:
Chromosome 5 (position 34912484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAATGTGTGTGTATAACGTTTCTAGCTGTGGACAATGGGATGGTGTT[G/T]AGTTGCCACTTTGTGAGGCCTTTCATCGGCAGGACAGTTGGGGGTCCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i85a6v0a