picalml

Ensembl ID:
ENSDARG00000014137
ZFIN ID:
ZDB-GENE-030131-6795
Description:
Novel protein similar to vertebrate phosphatidylinositol binding clathrin assembly protein (PICALM)
Human Orthologue:
PICALM
Human Description:
phosphatidylinositol binding clathrin assembly protein [Source:HGNC Symbol;Acc:15514]
Mouse Orthologue:
Picalm
Mouse Description:
phosphatidylinositol binding clathrin assembly protein Gene [Source:MGI Symbol;Acc:MGI:2385902]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9760 Essential Splice Site Available for shipment Available now
sa2794 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa9760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114888 Essential Splice Site 44 466 1 13
Genomic Location (Zv9):
Chromosome 15 (position 18733492)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19836118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCGACAACGCACGAAATCATGGGCCCGAAAAAGAAACACTTGGATTG[T/A]GAGTATTGTGCGGTTTGGTGTGGATTTGCGATRACGGACGGGTGTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2794
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114888 Essential Splice Site 415 466 12 13
Genomic Location (Zv9):
Chromosome 15 (position 18709284)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19811910
KASP Assay ID:
554-2745.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAGTCCAGCATGCAGCCGGGACCGTCTGTGGCCACGGCATGGGGAGG[T/C]AAACGCTCTCTTGCACGTTTCAGCCACTCAAGCATGCTGTAGTCTTCTCY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link