prkacaa

Ensembl ID:
ENSDARG00000014134
ZFIN IDs:
ZDB-GENE-050114-6, ZDB-GENE-050114-6
Description:
cAMP-dependent protein kinase catalytic subunit alpha [Source:RefSeq peptide;Acc:NP_001076309]
Human Orthologues:
PRKACA, PRKACG
Human Descriptions:
protein kinase, cAMP-dependent, catalytic, alpha [Source:HGNC Symbol;Acc:9380]
protein kinase, cAMP-dependent, catalytic, gamma [Source:HGNC Symbol;Acc:9382]
Mouse Orthologue:
Prkaca
Mouse Description:
protein kinase, cAMP dependent, catalytic, alpha Gene [Source:MGI Symbol;Acc:MGI:97592]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40160 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018726 Nonsense 309 352 9 10
ENSDART00000122721 Nonsense 296 339 9 10
Genomic Location (Zv9):
Chromosome 3 (position 50623610)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 45318030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCAAGGGCCACAAATGGTTTGCAACCACCGACTGGATTGCAATCTAC[C/T]AGAAGAAGGTACCTAGAGAACACTGCAGCTAAAACTTCACTGTCAATCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link