gspt1l

Ensembl ID:
ENSDARG00000014123
ZFIN ID:
ZDB-GENE-030131-4009
Description:
G1 to S phase transition 1, like [Source:RefSeq peptide;Acc:NP_942101]
Human Orthologues:
GSPT1, GSPT2
Human Descriptions:
G1 to S phase transition 1 [Source:HGNC Symbol;Acc:4621]
G1 to S phase transition 2 [Source:HGNC Symbol;Acc:4622]
Mouse Orthologues:
Gspt1, Gspt2
Mouse Descriptions:
G1 to S phase transition 1 Gene [Source:MGI Symbol;Acc:MGI:1316728]
G1 to S phase transition 2 Gene [Source:MGI Symbol;Acc:MGI:1316727]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40114 Nonsense Mutation detected in F1 DNA During 2017
sa26115 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016780 Nonsense 182 577 5 14
ENSDART00000143755   None 166 None 4
Genomic Location (Zv9):
Chromosome 3 (position 36537755)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36511349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTAATTCCGGCTCTCCACTGCAGGTATTTAACAGGAATGGTGGACAAA[C/T]GAACTCTGGAGAAGTATGAGAGAGAGGCCAAGGAGAAGAACAGGGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016780 Essential Splice Site 199 577 5 14
ENSDART00000143755   None 166 None 4
Genomic Location (Zv9):
Chromosome 3 (position 36537701)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36511403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGAGAAGTATGAGAGAGAGGCCAAGGAGAAGAACAGGGAAACTTGG[T/G]AATTACTGAAGTTAATATATTATTTTACCTGAACTTCTGCTGGCGGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link