pkd2

Ensembl ID:
ENSDARG00000014098
ZFIN ID:
ZDB-GENE-040827-4
Description:
polycystin-2 [Source:RefSeq peptide;Acc:NP_001002310]
Human Orthologue:
PKD2
Human Description:
polycystic kidney disease 2 (autosomal dominant) [Source:HGNC Symbol;Acc:9009]
Mouse Orthologue:
Pkd2
Mouse Description:
polycystic kidney disease 2 Gene [Source:MGI Symbol;Acc:MGI:1099818]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18074 Essential Splice Site Available for shipment Available now
sa18283 Nonsense Available for shipment Available now
sa38295 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020412 Essential Splice Site 135 904 1 14
Genomic Location (Zv9):
Chromosome 1 (position 51046742)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49895833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAAGAGCACCGCAGCTGTGGGAAGAGGATACTGGAGAAAATGAGAGG[T/G]CAAACTTTTGCTTGTWTTGTYTTATTRAAGTGCTACTNNNNNAASCATTGTTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020412 Nonsense 153 904 2 14
Genomic Location (Zv9):
Chromosome 1 (position 51048317)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49897408
KASP Assay ID:
2259-1099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGATACTCGTCTTTTGGGTGAGAGCAACAGTAACAGAGAGATGTACT[T/A]GAAAACSGTCCTGCGAGAAATGATCACCTACATCCTCTTCCTGCTCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020412 Nonsense 714 904 11 14
Genomic Location (Zv9):
Chromosome 1 (position 51058499)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49907590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGTATGACCTTGACGGAGATCAGGAGCTGACCGAACATGAGCACCAG[C/T]AGATGAGAGACGACCTGGAGAAAGAGAGAGTGAGTGAAAAACCAGTGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link