osr1

Ensembl ID:
ENSDARG00000014091
ZFIN ID:
ZDB-GENE-070321-1
Description:
Protein odd-skipped-related 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJQ7]
Human Orthologue:
OSR1
Human Description:
odd-skipped related 1 (Drosophila) [Source:HGNC Symbol;Acc:8111]
Mouse Orthologue:
Osr1
Mouse Description:
odd-skipped related 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344424]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020270 Nonsense 262 264 3 3
Genomic Location:
Chromosome 13 (position 32373370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCGTCCACAAAACATTACACATGCAGGTCAAGGAGCTCAAGCCAGCC[A/T]AGATAAAGTAAAGGCATTTGCTTTCATYAGTGGGGACGCTATAAAACCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xwjm8o0s