fam184a

Ensembl ID:
ENSDARG00000014081
ZFIN ID:
ZDB-GENE-041014-214
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5SPS1]
Human Orthologue:
FAM184A
Human Description:
family with sequence similarity 184, member A [Source:HGNC Symbol;Acc:20991]
Mouse Orthologue:
Fam184a
Mouse Description:
family with sequence similarity 184, member A Gene [Source:MGI Symbol;Acc:MGI:1923156]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17922 Nonsense Available for shipment Available now
sa19241 Nonsense Mutation detected in F1 DNA During 2014
sa13959 Nonsense Available for shipment Available now
sa12300 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Nonsense 22 1051 1 18
ENSDART00000135715 None None 1085 None 18
ENSDART00000138686 None None 1036 None 17
Genomic Location:
Chromosome 20 (position 41581531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGGCAGCACTATTACAACCCCGCTGGCAGCGCWTCGACGGGGAAATA[T/G]AACAGCACCTCCACTTCAACATCCACCAGCACGTCCTTCCCRTCCGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Nonsense 442 1051 5 18
ENSDART00000135715 Nonsense 382 1085 4 18
ENSDART00000138686 Nonsense 382 1036 4 17
Genomic Location:
Chromosome 20 (position 41687332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGAGAGGAGCGCTGCAGAACAAATGTCAGACGCTGGACGACCGG[C/T]AGAGACAGCAGATCGTCACACTGGAGAAGGTATGAATCCATATGCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Nonsense 744 1051 11 18
ENSDART00000135715 Nonsense 684 1085 10 18
ENSDART00000138686 Nonsense 684 1036 10 17
Genomic Location:
Chromosome 20 (position 41736649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCGGGAACACCTGGGCCAGCAGCTGGAGGAGATGGAGATGGAGCAC[C/T]AGCACAGACAGCAGCGGCTRCAGGAGGCTCACTGCTGYGCCATACAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Essential Splice Site 822 1051 13 18
ENSDART00000135715 Essential Splice Site 762 1085 12 18
ENSDART00000138686 Essential Splice Site 762 1036 12 17
Genomic Location:
Chromosome 20 (position 41766012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATAGTCTTGTTTGTCATTTTTCTCTGTCTCTCTCTTTTTCTMGTCTTC[A/C]GCGTCGCTTCGTTCTGAGCTCWACCATCTCCACGCATCAGCCATTGAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7y24m932