rab36

Ensembl ID:
ENSDARG00000014058
ZFIN ID:
ZDB-GENE-040910-5
Description:
ras-related protein Rab-36 [Source:RefSeq peptide;Acc:NP_001073128]
Human Orthologue:
RAB36
Human Description:
RAB36, member RAS oncogene family [Source:HGNC Symbol;Acc:9775]
Mouse Orthologue:
Rab36
Mouse Description:
RAB36, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1924127]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5827 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15117 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038577 Essential Splice Site None 262 1 11
ENSDART00000135679 Essential Splice Site None 261 1 11
Genomic Location:
Chromosome 10 (position 16918719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGTGAACGCGCATTCAGCAGGAATAAACTGCGCTTCAGAAACATCCG[T/C]GAGTACGAGACTGCTTTAATATACACAATCCTAGTTAGAAATAATGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038577 Essential Splice Site 245 262 10 11
ENSDART00000135679 Essential Splice Site 244 261 10 11
Genomic Location:
Chromosome 10 (position 16926928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCTGGGACCACCAGCAGCACTCAGATCGGAGATGGCARTATTCTCAG[T/C]AAGAGAAACATCATAAATCTGACATGATGAGGATAATATTGGGTTGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6s1ohc5j