olfm1b

Ensembl ID:
ENSDARG00000014053
ZFIN ID:
ZDB-GENE-040801-228
Description:
olfactomedin 1b [Source:RefSeq peptide;Acc:NP_001003486]
Mouse Orthologue:
Olfm1
Mouse Description:
olfactomedin 1 Gene [Source:MGI Symbol;Acc:MGI:1860437]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa157 Nonsense F2 line generated During 2016
sa16075 Essential Splice Site Available for shipment Available now
sa37229 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa157
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037265 Nonsense 33 125 2 4
ENSDART00000135914   None 75 None 3
ENSDART00000139493 Nonsense 61 153 2 4
ENSDART00000140478 Nonsense 61 485 2 6
ENSDART00000146371 Nonsense 33 457 2 6
Genomic Location (Zv9):
Chromosome 21 (position 6738740)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6859832
KASP Assay ID:
554-0018.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTTGTCCTCTGCCAGGTTTTACCCGCTAACCCAGAGGAGTCCTGG[C/T]AAGTGTACAGCTCGGCTCAGGACAGCGAGGGCAGATGTGTGTGTACAGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037265 Essential Splice Site 73 125 3 4
ENSDART00000135914 Essential Splice Site 23 75 2 3
ENSDART00000139493 Essential Splice Site 101 153 3 4
ENSDART00000140478 Essential Splice Site 101 485 3 6
ENSDART00000146371 Essential Splice Site 73 457 3 6
Genomic Location (Zv9):
Chromosome 21 (position 6741562)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6862654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGYACTAAACTCATTGTATTCCCTGGYACCTTCTATATGTGCYTTTA[G/A]GTGCAAAACATGAYGCAATCAATCCAAGTWTTGGACCAGCGGACCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037265 Nonsense 109 125 3 4
ENSDART00000135914 Nonsense 59 75 2 3
ENSDART00000139493 Nonsense 137 153 3 4
ENSDART00000140478 Nonsense 137 485 3 6
ENSDART00000146371 Nonsense 109 457 3 6
Genomic Location (Zv9):
Chromosome 21 (position 6741671)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6862763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACGTGGTAAAGATGGAGGATCAACTCCGTGGCCTGGAGACCAAATTC[A/T]GACAGGTGGAAGAGAACCACAAACAAAACATCGCCAAGCAATACAAGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link