olfm1b

Ensembl ID:
ENSDARG00000014053
ZFIN ID:
ZDB-GENE-040801-228
Description:
olfactomedin 1b [Source:RefSeq peptide;Acc:NP_001003486]
Mouse Orthologue:
Olfm1
Mouse Description:
olfactomedin 1 Gene [Source:MGI Symbol;Acc:MGI:1860437]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa157 Nonsense F2 line generated During 2014
sa16075 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa157
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037265 Nonsense 33 125 2 4
ENSDART00000135914 None None 75 None 3
ENSDART00000139493 Nonsense 61 153 2 4
ENSDART00000140478 Nonsense 61 485 2 6
ENSDART00000146371 Nonsense 33 457 2 6
Genomic Location:
Chromosome 21 (position 6738740)
KASP Assay ID:
554-0018.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTTGTCCTCTGCCAGGTTTTACCCGCTAACCCAGAGGAGTCCTGG[C/T]AAGTGTACAGCTCGGCTCAGGACAGCGAGGGCAGATGTGTGTGTACAGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037265 Essential Splice Site 73 125 3 4
ENSDART00000135914 Essential Splice Site 23 75 2 3
ENSDART00000139493 Essential Splice Site 101 153 3 4
ENSDART00000140478 Essential Splice Site 101 485 3 6
ENSDART00000146371 Essential Splice Site 73 457 3 6
Genomic Location:
Chromosome 21 (position 6741562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGYACTAAACTCATTGTATTCCCTGGYACCTTCTATATGTGCYTTTA[G/A]GTGCAAAACATGAYGCAATCAATCCAAGTWTTGGACCAGCGGACCCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3bb0owfw