abcc2

Ensembl ID:
ENSDARG00000014031
ZFIN ID:
ZDB-GENE-040426-1523
Description:
canalicular multispecific organic anion transporter 1 [Source:RefSeq peptide;Acc:NP_956883]
Human Orthologue:
ABCC2
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 2 [Source:HGNC Symbol;Acc:53]
Mouse Orthologue:
Abcc2
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 2 Gene [Source:MGI Symbol;Acc:MGI:1352447]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22191 Nonsense Mutation detected in F1 DNA During 2014
sa3859 Nonsense Mutation detected in F1 DNA During 2014
sa6282 Nonsense Mutation detected in F1 DNA During 2014
sa11900 Essential Splice Site Available for shipment Available now
sa2688 Essential Splice Site Available for shipment Available now
sa19049 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 273 1553 6 31
ENSDART00000114538 Nonsense 277 1564 6 34
Genomic Location:
Chromosome 13 (position 556851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTACAGAAGAAGAAAAGCAAGAAACGCAAGACCGTAGATGCTGAGGGT[C/T]AGAACGGACTGGCCAAAGGGGTCAGTCAGGACGTGCTGGTCATGGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 527 1553 11 31
ENSDART00000114538 Nonsense 535 1564 13 34
Genomic Location:
Chromosome 13 (position 564422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGATGATGTTGTAGATCCTGAAGTATTAYGCCTGGGAAACATCCTTC[G/T]AGGCTCAGGTTCAGGAGATTCGGGAAAAAGAGCTGAAGGTGATGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 832 1553 18 31
ENSDART00000114538 Nonsense 840 1564 20 34
Genomic Location:
Chromosome 13 (position 573208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGCAGACTCGYATCTTGGTAACTCATGGAATCAGCTTCTTGCCGTA[T/A]GTAGATGAGATTGTAGTGTTGGTGCATGGCGTCGTGTCTGAGATCGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Essential Splice Site 1142 1553 23 31
ENSDART00000114538 Essential Splice Site 1152 1564 25 34
Genomic Location:
Chromosome 13 (position 577918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTMACTGCGGTTGTTGTACCGATGGCTGTTGTCTACTACTTTGTGCAG[G/T]TAACACAGATACCAGTAYTRACGAAAACTGTNNNTATATCAGTGGTGGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Essential Splice Site 1251 1553 25 31
ENSDART00000114538 Essential Splice Site 1261 1564 27 34
Genomic Location:
Chromosome 13 (position 578886)
KASP Assay ID:
554-2727.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTCTGAACAGCGGACTGGTCGGACTGTCCATCTCATACGCTTTAAAT[G/A]TAAATGCTTAAATCTGATGTATTTATGACAGTCAGCTGAAAGATCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 1361 1553 28 31
ENSDART00000114538 Nonsense 1371 1564 30 34
Genomic Location:
Chromosome 13 (position 580700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCAGCCTGACCAACTGCTTGTTCCGCATCGTTGAAGCTGCGGACGGT[C/T]GAATCCTCATCGATGATATCGACATTGCCACGCTGGGACTCCACGATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0bzykkqv