ms4a17a.4

Ensembl ID:
ENSDARG00000014024
ZFIN IDs:
ZDB-GENE-070822-16, ZDB-GENE-070822-16
Description:
membrane-spanning 4-domains, subfamily A, member 17A.4 [Source:RefSeq peptide;Acc:NP_001096108]
Human Orthologues:
MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
Human Descriptions:
Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
Mouse Orthologues:
AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
Mouse Descriptions:
membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5273 Nonsense Mutation detected in F1 DNA During 2014
sa14040 Nonsense Available for shipment Available now
sa20316 Nonsense Mutation detected in F1 DNA During 2014
sa16945 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082121 Nonsense 49 246 2 7
ENSDART00000097323 Nonsense 49 246 2 7
Genomic Location:
Chromosome 4 (position 60797593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGTTTCACCTCTTCAAGGAATTCAGGCCTTTCTGAGAGGCCAACCG[A/T]AAGCCCTCGGGGTGAGAAATCTCCCTTAAACCCAGATAACACACATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082121 Nonsense 72 246 3 7
ENSDART00000097323 Nonsense 72 246 3 7
Genomic Location:
Chromosome 4 (position 60797778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATGATCGGTGTGTTGACCTTGYTGTTTGGAATMGYGTCTATAGGTTA[T/A]GAAATGTTTTTCTTCWTCAACACTGGTGTTTCTTACTGGGYATCTCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082121 Nonsense 213 246 7 7
ENSDART00000097323 Nonsense 213 246 7 7
Genomic Location:
Chromosome 4 (position 60803576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGAACAGCAACCCTTTAATTCAACACCCTCCTGCAGAAATGCCCCCA[C/T]AGTACATTCAATGTCCTCAAGAAGTCCCCGAACCATGCTTTCAACATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082121 Nonsense 243 246 7 7
ENSDART00000097323 Nonsense 243 246 7 7
Genomic Location:
Chromosome 4 (position 60803668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACRTCCTCCTGCAGAAKCTCCCCCAGCGTACACWGAANGCAAATAAWTR[T/A]GAATCAACATGAAAAACAGGGCAGCATATTGGTTCTGCTGCTTTGATGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kn9oftve