NFAT5 (1 of 2)

Ensembl ID:
ENSDARG00000014022
Description:
nuclear factor of activated T-cells 5, tonicity-responsive [Source:HGNC Symbol;Acc:7774]
Human Orthologue:
NFAT5
Human Description:
nuclear factor of activated T-cells 5, tonicity-responsive [Source:HGNC Symbol;Acc:7774]
Mouse Orthologue:
Nfat5
Mouse Description:
nuclear factor of activated T-cells 5 Gene [Source:MGI Symbol;Acc:MGI:1859333]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24800 Nonsense Available for shipment Available now
sa24801 Nonsense Available for shipment Available now
sa38182 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003603 Nonsense 100 1093 1 12
Genomic Location (Zv9):
Chromosome Zv9_NA324 (position 30667)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67180195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTTTCTGCGGAAGAGGCCAGCATGGATGTCTTTGATGCAGACAGTGCC[A/T]AAGGCCCGCACTTTGTGCTCTCACAACTCGGCCCAGACAGCAAGACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003603 Nonsense 333 1093 5 12
Genomic Location (Zv9):
Chromosome Zv9_NA324 (position 43787)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67193314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTACACAGCTGTTCGGTTAAAGGGGGGAATGAAGTCTTTATCATTGGA[A/T]AAAACTTTCTGAAAGGAACCAAGGTCATATTTCAGGAGAACGCTTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003603 Nonsense 1020 1093 12 12
Genomic Location (Zv9):
Chromosome Zv9_NA324 (position 46908)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67196434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATATTTTAAAACTCATTCTAATGATTTTATTTTTTGCAGAGTGCCGT[C/T]AACTCATGAACAGCCAAGGATCTACACTGTCTAATCAAATAATTACCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link