lhx1a

Ensembl ID:
ENSDARG00000014018
ZFIN ID:
ZDB-GENE-980526-347
Description:
LIM/homeobox protein Lhx1 [Source:UniProtKB/Swiss-Prot;Acc:Q90476]
Human Orthologue:
LHX1
Human Description:
LIM homeobox 1 [Source:HGNC Symbol;Acc:6593]
Mouse Orthologue:
Lhx1
Mouse Description:
LIM homeobox protein 1 Gene [Source:MGI Symbol;Acc:MGI:99783]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15189 Nonsense Available for shipment Available now
sa42561 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15800 Nonsense Available for shipment Available now
sa39051 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005641 Nonsense 22 405 1 5
ENSDART00000134373 Nonsense 22 97 2 3
Genomic Location:
Chromosome 15 (position 27059150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGCTGCGAGAGGCCTATATTGGACAGGTTTCTCCTTAATGTTCTGGAC[A/T]GAGCATGGCACAKCAAGTGCGTACAGTGCTGCGAGTGCAAATGTAACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005641 Essential Splice Site 57 405 None 5
ENSDART00000134373 Essential Splice Site 57 97 None 3
Genomic Location:
Chromosome 15 (position 27059042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCTTCTCTCGAGAAGGAAAACTATATTGCAAAAACGACTTCTTTAGG[T/A]AAGTTCCTTGCGTGAGTTAATTCGACCAAATATTTTACTTGTGGGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005641 Nonsense 114 405 2 5
ENSDART00000134373   None 97 None 3
Genomic Location:
Chromosome 15 (position 27057573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCCACAGGAGAGGAATTGTACATCATAGAYGAAAATAAATTTGWCTG[T/A]AAAGAYGATTATTTAAGCAACACGAAYGGAAAAGACTCAAATCTCCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005641 Nonsense 147 405 3 5
ENSDART00000134373   None 97 None 3
Genomic Location:
Chromosome 15 (position 27056885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGTTACAGCTTGCAGTGATCCTAGTTTATCGCCAGATTCTCAAGAC[C/T]AGCTACAGGACGATGTCAAGGATGCGGAAATCGCAAATTTATCGGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link