lhx1a

Ensembl ID:
ENSDARG00000014018
ZFIN ID:
ZDB-GENE-980526-347
Description:
LIM/homeobox protein Lhx1 [Source:UniProtKB/Swiss-Prot;Acc:Q90476]
Human Orthologue:
LHX1
Human Description:
LIM homeobox 1 [Source:HGNC Symbol;Acc:6593]
Mouse Orthologue:
Lhx1
Mouse Description:
LIM homeobox protein 1 Gene [Source:MGI Symbol;Acc:MGI:99783]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15189 Nonsense Available for shipment Available now
sa15800 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005641 Nonsense 22 405 1 5
ENSDART00000134373 Nonsense 22 97 2 3
Genomic Location:
Chromosome 15 (position 27059150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGCTGCGAGAGGCCTATATTGGACAGGTTTCTCCTTAATGTTCTGGAC[A/T]GAGCATGGCACAKCAAGTGCGTACAGTGCTGCGAGTGCAAATGTAACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005641 Nonsense 114 405 2 5
ENSDART00000134373 None None 97 None 3
Genomic Location:
Chromosome 15 (position 27057573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCCACAGGAGAGGAATTGTACATCATAGAYGAAAATAAATTTGWCTG[T/A]AAAGAYGATTATTTAAGCAACACGAAYGGAAAAGACTCAAATCTCCTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ydsu7pe7