rrm1

Ensembl ID:
ENSDARG00000014017
ZFIN ID:
ZDB-GENE-990415-247
Description:
Ribonucleoside-diphosphate reductase large subunit [Source:UniProtKB/Swiss-Prot;Acc:P79732]
Human Orthologue:
RRM1
Human Description:
ribonucleotide reductase M1 [Source:HGNC Symbol;Acc:10451]
Mouse Orthologue:
Rrm1
Mouse Description:
ribonucleotide reductase M1 Gene [Source:MGI Symbol;Acc:MGI:98180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25163 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012091 Essential Splice Site 96 794 3 19
ENSDART00000078042 Essential Splice Site 96 498 3 15
Genomic Location (Zv9):
Chromosome 21 (position 29548044)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30748295
KASP Assay ID:
554-7653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATCGCCGTGTCTAACCTGCATAAAGAGACTAAGAAGGTTTTCAGTGG[T/G]GAGTTGCGACGACCAGTTTAACGTCAATGATTTAACTTCAGTTGAATTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link