lbr

Ensembl ID:
ENSDARG00000014013
ZFIN ID:
ZDB-GENE-030804-11
Description:
lamin-B receptor [Source:RefSeq peptide;Acc:NP_001002720]
Human Orthologue:
LBR
Human Description:
lamin B receptor [Source:HGNC Symbol;Acc:6518]
Mouse Orthologue:
Lbr
Mouse Description:
lamin B receptor Gene [Source:MGI Symbol;Acc:MGI:2138281]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15675 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019145 Nonsense 434 619 10 14
ENSDART00000076419 Nonsense 427 612 15 19
ENSDART00000122527 Nonsense 434 619 9 13
Genomic Location:
Chromosome 20 (position 36424331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAATCCGTCTCCAGCGATGCTCCTGGTCAACATYTTCCAGCTCCTGTG[G/A]GTCATCGATGGCTTGTGGCATGAGGTACARNNNGTGTTTTTCAAATCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ssh2nc62