lrrc45

Ensembl ID:
ENSDARG00000014005
Human Orthologue:
LRRC45
Human Description:
leucine rich repeat containing 45 [Source:HGNC Symbol;Acc:28302]
Mouse Orthologue:
Lrrc45
Mouse Description:
leucine rich repeat containing 45 Gene [Source:MGI Symbol;Acc:MGI:2387183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31851 Essential Splice Site Available for shipment Available now
sa17335 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082297 Essential Splice Site 284 678 7 17
Genomic Location (Zv9):
Chromosome 12 (position 3593652)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2967172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGGAGACCATTGACAGACAGAAAGGCGAGATGGGAAGAAGCAGCAG[G/A]TTAGTGTCACTTTTAAAGGATAGTTCACCCAAAACTGACAACTTAAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082297 Nonsense 443 678 12 17
Genomic Location (Zv9):
Chromosome 12 (position 3600529)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2974049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGAGAAGAGCAAAGCAGGCACTTGAAGACATGGACGGTTTAAGGCAG[A/T]AAGAGGTGAAGATGTTGGACTGCACTAGTTTTATTTACAAGAAAATGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link