eif2b4

Ensembl ID:
ENSDARG00000014004
ZFIN ID:
ZDB-GENE-030131-955
Description:
translation initiation factor eIF-2B subunit delta [Source:RefSeq peptide;Acc:NP_001014383]
Human Orthologue:
EIF2B4
Human Description:
eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa [Source:HGNC Symbol;Acc:3260]
Mouse Orthologue:
Eif2b4
Mouse Description:
eukaryotic translation initiation factor 2B, subunit 4 delta Gene [Source:MGI Symbol;Acc:MGI:95300]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17367 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026239 Essential Splice Site 475 541 12 13
ENSDART00000125830 Essential Splice Site 474 540 12 13
Genomic Location:
Chromosome 20 (position 19590687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTTCTGTGAACGAGTGCAGACGGACTCTTTTGTATCCAATGAATTAG[G/A]TAACTGTCATGTTGTGCTTACTTAATAAAATTTGCATCATTTTATTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6hz3jm2e