si:ch211-124k10.2

Ensembl ID:
ENSDARG00000014003
ZFIN ID:
ZDB-GENE-030131-9447
Description:
StAR-related lipid transfer domain containing 8 [Source:RefSeq peptide;Acc:NP_001119949]
Human Orthologue:
STARD8
Human Description:
StAR-related lipid transfer (START) domain containing 8 [Source:HGNC Symbol;Acc:19161]
Mouse Orthologue:
Stard8
Mouse Description:
START domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:2448556]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1039 Essential Splice Site F2 line generated During 2017
sa940 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1039
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022043 Essential Splice Site 39 614 1 9
ENSDART00000051333 Essential Splice Site 39 1076 1 14
ENSDART00000127383 Essential Splice Site 39 1076 1 14
Genomic Location (Zv9):
Chromosome 5 (position 37404493)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35186442
KASP Assay ID:
554-0942.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCCCTGACTTTACTGCGGAGGAAGGCGAAACAGCGGCAGTTTGCGGG[T/A]AAGTWATGCCACTGTTTGGAGGAGGCTGTGAGATTTTCTTAAGAAACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa940
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022043 Nonsense 375 614 5 9
ENSDART00000051333 Nonsense 375 1076 5 14
ENSDART00000127383 Nonsense 375 1076 5 14
Genomic Location (Zv9):
Chromosome 5 (position 37461844)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35243793
KASP Assay ID:
554-0845.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCACAAGCCTGGAACTTTCCCCAAATCTCTGTCAATTGAAAGTCTCTG[T/A]CCTGTCTCTGTTTCTGAAAGTCCTGACCATATTGACTGGGCAGRAGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link